Chapter 159 Is this a human gene fragment?
Chapter 159 Is this a human gene fragment?
The discovery on Europa has almost completely confirmed the "white chimney hypothesis".
Life is born accidentally from a series of molecular movements and chemical reactions without rules!
The Jupiter Gravity Rover found more complete evidence in its subsequent exploration of these five points.
"Detector No. 1 discovered proteins and RNA in the inner cavity of No. 25. This evidence proves that early proteins were actually RNA nucleotide chains, which happened to be born after polymerizing organic acids to generate amino acid chains."
"Yes, Detector No. 6 even discovered complete reverse transcriptase RNA and DNA."
"DNA, RNA, protein, the most primitive central dogma is formed!"
"We finally discovered the most important evidence for the origin of life. The 'white chimney' hypothesis is completely feasible!"
Now, every second we stay will make the theory of the origin of life one step closer.
Zhang Xu and the scientists on the ship have fallen into madness.
They were simply tireless in their research!
Naturally formed primitive DNA, RNA, proteins, and even various enzymes.
This is a paradise for studying the origin of life!
among the five points detected.
Numbers 2, 4, and 5 have a low degree of evolution and have been detected multiple times. There are only a large amount of ribose and deoxyribose in the inner cavity.
Numbers 1 and 6 are highly evolved.
Zhang Xu even found a decisive piece of evidence in the white sedimentary rock pillars of the No. 1 detector.
That's chamber number 89!
In the inner cavity, the most primitive lipids are connected together, and under the hydrophobic effect, iron-sulfur proteins, DNA, RNA and various enzymes are wrapped, forming the most primitive life - Luca!
That's right,
In the inner cavity of No. 89, primitive life has appeared.
The primitive cell that carries out inheritance through RNA, Luca!
"Luca, the prototype of life, has appeared on Europa!!!"
Zhang Xu looked at the data reported by the No. 1 detector, his eyes filled with wonder.
The origin of life that has been debated in this universe for hundreds of years has now come to an end in his hands.
There is no designer in life.
It is just billions of "white chimney"-like structures that were born by chance over hundreds of millions of years due to the availability of suitable raw materials.
At this point, the first exploration of Jupiter Gravity is over.
"Just one exploration has completely confirmed the secret of the origin of life."
Zhang Xu focused his attention on the entire Europa.
He was sure that there must be more than these discoveries on this satellite.
Each geological activity point is actually a small world. Some develop slowly and some develop quickly.
This exploration only detected six points.
There are at least thousands of geological activity points like this.
Maybe, in some places, not only Luka has evolved, but even more advanced life forms have evolved!
It's all possible!
Zhang Xu is already looking forward to the next detection.
Fang Jing and Zhou Yuan, who were watching the show on the sidelines, were also eye-opening at this time.
Therefore, life has been discovered on Europa!
Although it is just a primitive life, similar to Luca.
However, this is also major news that is enough to shock the entire human world.
Who are we?
Where do we come from?
Where are we going?
These three ultimate questions of mankind, where do we come from? Now, there is an answer.
The origin of life has been found!
The road ahead is known, and the great eastern country will move firmly into the future!
…
After completing the early detection of Europa, Fang Jing and the others entered the dormant state again.
hibernate,
To Fang Jing, it was like falling asleep.
By the time he opened his eyes again, half a year had passed.
He has returned to the west mountain base, the underground part.
That's right,
After the Jupiter Gravity landed, he and Zhou Yuan were sent directly back to the base together with the sleeping capsule.
"呲呲呲——"
As the sleep hatch cover slowly opened, Fang Jing slowly sat up.
"Welcome back."
Zhao Guangyao stood aside with a smile on his face.
"Brother Zhao, are we here now?"
I rubbed my confused head, it felt strange to be asleep.
He was still in the orbit of Jupiter before going to bed, and when he woke up, he was back at the Xishan Base!
"Hey, you kid, you're still confused."
Zhao Guangyao made sure that Fang Jing and Zhou Yuan were fine, grinned, helped Fang Jing up, patted Fang Jing on the shoulder, and said:
"It can't be that I'm in Jupiter's orbit, right?"
"Welcome back."
"King Sun, take this person down and recover well."
…
Xishan base, underground part, expert group research room.
Fang Jing was sitting on the computer desk, typing a series of letters on the computer listlessly.
“AACATGAAGGTTTTGGCCAA…”
"Crack!"
As the last letter was typed, Fang Jing breathed a sigh of relief and slumped in his seat.
"More than 100,000 letters, I almost died!"
With a wail, Fang Jing almost fell asleep.
He has been back for half a month, and he comes here every day to enter the letters prompted by the machine.
After review by the expert group.
This string of letters is indeed bases, genetic information!
"Fang, is the input complete?"
Beside Fang Jing, Dr. Shirelle, with a full head of white hair, was smiling.
This was the master specially invited by Mr. Zhu.
He could be said to be the strongest biologist in Kyushu!
"I have finished inputting!"
Fang Jing nodded weakly to confirm.
"Well, let's start the comparison."
Dr. Shirelle nodded and pressed the comparison button on the computer in his hand.
Quantum computer, start!
The comparison begins!
The genetic information input by Fang Jing was jumping at a rapid speed, under the powerful parallel computing power of quantum computing.
It was compared with the different genetic information of all species on the earth at the same time!
[Comparison data completed, the similarity between this genetic information and human gene fragments reached 99.995%. It was initially judged that it was a human gene fragment that was input incorrectly, and the wrong fragment had been marked. ]
Compared by the quantum computer, this is actually a human gene fragment? ? ?
"Human gene fragment?"
Shirelle's eyes widened. He first called out the possible wrong fragment in confusion, and then handed it to Fang Jing.
"Fang, check and see if you made any mistakes."
"Okay."
Fang Jing was also confused at this time.
Damn, human genes? ?
What's going on!
He entered the consciousness cautiously and touched the machine.
The familiar letters appeared in his mind again.
Fang Jing compared them and his eyes widened suddenly.
"I didn't make any mistakes!"
"I didn't make any mistakes?"
Shirelle frowned, nodded slowly, and focused his eyes on those "different" fragments.
Since there are differences with human gene fragments, Fang didn't make any mistakes.
Then it can only be possible that they are not human!
But...
"These gene fragments, although different, are exactly the same as human genes in terms of trait expression."
This made Shirelle even more confused.
In other words,
Although the genes entered by Fang are different in genetic information, when they are really expressed in biological individuals, the differences will be very small.
So small that they are difficult to distinguish!
What kind of operation is this?
deltrittennovels